Press Enter

PROJECT TITLE

    Press Enter

    ebola genome

    >AF086833 Ebola virus – Mayinga, Zaire, 1976, complete genome
    CGGACACACAAAAAGAAAGAAGAATTTTTAGGATCTTTTGTGTGCGAATAACTATGAGGA
    AGATTAATAATTTTCCTCTCATTGAAATTTATATCGGAATTTAAATTGAAATTGTTACTG
    TAATCACACCTGGTTTGTTTCAGAGCCACATCACAAAGATAGAGAACAACCTAGGTCTCC
    GAAGGGAGCAAGGGCATCAGTGTGCTCAGTTGAAAATCCCTTGTCAACACCTAGGTCTTA
    TCACATCACAAGTTCCACCTCAGACTCTGCAGGGTGATCCAACAACCTTAATAGAAACAT
    TATTGTTAAAGGACAGCATTAGTTCACAGTCAAACAAGCAAGATTGAGAATTAACCTTGG
    TTTTGAACTTGAACACTTAGGGGATTGAAGATTCAACAACCCTAAAGCTTGGGGTAAAAC
    ATTGGAAATAGTTAAAAGACAAATTGCTCGGAATCACAAAATTCCGAGTATGGATTCTCG
    TCCTCAGAAAATCTGGATGGCGCCGAGTCTCACTGAATCTGACATGGATTACCACAAGAT
    CTTGACAGCAGGTCTGTCCGTTCAACAGGGGATTGTTCGGCAAAGAGTCATCCCAGTGTA
    TCAAGTAAACAATCTTGAAGAAATTTGCCAACTTATCATACAGGCCTTTGAAGCAGGTGT
    TGATTTTCAAGAGAGTGCGGACAGTTTCCTTCTCATGCTTTGTCTTCATCATGCGTACCA
    GGGAGATTACAAACTTTTCTTGGAAAGTGGCGCAGTCAAGTATTTGGAAGGGCACGGGTT
    CCGTTTTGAAGTCAAGAAGCGTGATGGAGTGAAGCGCCTTGAGGAATTGCTGCCAGCAGT
    ATCTAGTGGAAAAAACATTAAGAGAACACTTGCTGCCATGCCGGAAGAGGAGACAACTGA
    AGCTAATGCCGGTCAGTTTCTCTCCTTTGCAAGTCTATTCCTTCCGAAATTGGTAGTAGG
    AGAAAAGGCTTGCCTTGAGAAGGTTCAAAGGCAAATTCAAGTACATGCAGAGCAAGGACT
    GATACAATATCCAACAGCTTGGCAATCAGTAGGACACATGATGGTGATTTTCCGTTTGAT
    GCGAACAAATTTTCTGATCAAATTTCTCCTAATACACCAAGGGATGCACATGGTTGCCGG
    GCATGATGCCAACGATGCTGTGATTTCAAATTCAGTGGCTCAAGCTCGTTTTTCAGGCTT
    ATTGATTGTCAAAACAGTACTTGATCATATCCTACAAAAGACAGAACGAGGAGTTCGTCT
    CCATCCTCTTGCAAGGACCGCCAAGGTAAAAAATGAGGTGAACTCCTTTAAGGCTGCACT
    CAGCTCCCTGGCCAAGCATGGAGAGTATGCTCCTTTCGCCCGACTTTTGAACCTTTCTGG
    AGTAAATAATCTTGAGCATGGTCTTTTCCCTCAACTATCGGCAATTGCACTCGGAGTCGC
    CACAGCACACGGGAGTACCCTCGCAGGAGTAAATGTTGGAGAACAGTATCAACAACTCAG
    AGAGGCTGCCACTGAGGCTGAGAAGCAACTCCAACAATATGCAGAGTCTCGCGAACTTGA
    CCATCTTGGACTTGATGATCAGGAAAAGAAAATTCTTATGAACTTCCATCAGAAAAAGAA
    CGAAATCAGCTTCCAGCAAACAAACGCTATGGTAACTCTAAGAAAAGAGCGCCTGGCCAA
    GCTGACAGAAGCTATCACTGCTGCGTCACTGCCCAAAACAAGTGGACATTACGATGATGA
    TGACGACATTCCCTTTCCAGGACCCATCAATGATGACGACAATCCTGGCCATCAAGATGA
    TGATCCGACTGACTCACAGGATACGACCATTCCCGATGTGGTGGTTGATCCCGATGATGG
    AAGCTACGGCGAATACCAGAGTTACTCGGAAAACGGCATGAATGCACCAGATGACTTGGT
    CCTATTCGATCTAGACGAGGACGACGAGGACACTAAGCCAGTGCCTAATAGATCGACCAA
    GGGTGGACAACAGAAGAACAGTCAAAAGGGCCAGCATATAGAGGGCAGACAGACACAATC
    CAGGCCAATTCAAAATGTCCCAGGCCCTCACAGAACAATCCACCACGCCAGTGCGCCACT
    CACGGACAATGACAGAAGAAATGAACCCTCCGGCTCAACCAGCCCTCGCATGCTGACACC
    AATTAACGAAGAGGCAGACCCACTGGACGATGCCGACGACGAGACGTCTAGCCTTCCGCC
    CTTGGAGTCAGATGATGAAGAGCAGGACAGGGACGGAACTTCCAACCGCACACCCACTGT
    CGCCCCACCGGCTCCCGTATACAGAGATCACTCTGAAAAGAAAGAACTCCCGCAAGACGA
    GCAACAAGATCAGGACCACACTCAAGAGGCCAGGAACCAGGACAGTGACAACACCCAGTC
    AGAACACTCTTTTGAGGAGATGTATCGCCACATTCTAAGATCACAGGGGCCATTTGATGC
    TGTTTTGTATTATCATATGATGAAGGATGAGCCTGTAGTTTTCAGTACCAGTGATGGCAA
    AGAGTACACGTATCCAGACTCCCTTGAAGAGGAATATCCACCATGGCTCACTGAAAAAGA
    GGCTATGAATGAAGAGAATAGATTTGTTACATTGGATGGTCAACAATTTTATTGGCCGGT
    GATGAATCACAAGAATAAATTCATGGCAATCCTGCAACATCATCAGTGAATGAGCATGGA
    ACAATGGGATGATTCAACCGACAAATAGCTAACATTAAGTAGTCAAGGAACGAAAACAGG
    AAGAATTTTTGATGTCTAAGGTGTGAATTATTATCACAATAAAAGTGATTCTTATTTTTG
    AATTTAAAGCTAGCTTATTATTACTAGCCGTTTTTCAAAGTTCAATTTGAGTCTTAATGC
    AAATAGGCGTTAAGCCACAGTTATAGCCATAATTGTAACTCAATATTCTAACTAGCGATT
    TATCTAAATTAAATTACATTATGCTTTTATAACTTACCTACTAGCCTGCCCAACATTTAC
    ACGATCGTTTTATAATTAAGAAAAAACTAATGATGAAGATTAAAACCTTCATCATCCTTA
    CGTCAATTGAATTCTCTAGCACTCGAAGCTTATTGTCTTCAATGTAAAAGAAAAGCTGGT
    CTAACAAGATGACAACTAGAACAAAGGGCAGGGGCCATACTGCGGCCACGACTCAAAACG
    ACAGAATGCCAGGCCCTGAGCTTTCGGGCTGGATCTCTGAGCAGCTAATGACCGGAAGAA
    TTCCTGTAAGCGACATCTTCTGTGATATTGAGAACAATCCAGGATTATGCTACGCATCCC
    AAATGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGTCAAACCCAAACGGACCCAA
    TTTGCAATCATAGTTTTGAGGAGGTAGTACAAACATTGGCTTCATTGGCTACTGTTGTGC
    AACAACAAACCATCGCATCAGAATCATTAGAACAACGCATTACGAGTCTTGAGAATGGTC
    TAAAGCCAGTTTATGATATGGCAAAAACAATCTCCTCATTGAACAGGGTTTGTGCTGAGA
    TGGTTGCAAAATATGATCTTCTGGTGATGACAACCGGTCGGGCAACAGCAACCGCTGCGG
    CAACTGAGGCTTATTGGGCCGAACATGGTCAACCACCACCTGGACCATCACTTTATGAAG
    AAAGTGCGATTCGGGGTAAGATTGAATCTAGAGATGAGACCGTCCCTCAAAGTGTTAGGG
    AGGCATTCAACAATCTAAACAGTACCACTTCACTAACTGAGGAAAATTTTGGGAAACCTG
    ACATTTCGGCAAAGGATTTGAGAAACATTATGTATGATCACTTGCCTGGTTTTGGAACTG
    CTTTCCACCAATTAGTACAAGTGATTTGTAAATTGGGAAAAGATAGCAACTCATTGGACA
    TCATTCATGCTGAGTTCCAGGCCAGCCTGGCTGAAGGAGACTCTCCTCAATGTGCCCTAA
    TTCAAATTACAAAAAGAGTTCCAATCTTCCAAGATGCTGCTCCACCTGTCATCCACATCC
    GCTCTCGAGGTGACATTCCCCGAGCTTGCCAGAAAAGCTTGCGTCCAGTCCCACCATCGC
    CCAAGATTGATCGAGGTTGGGTATGTGTTTTTCAGCTTCAAGATGGTAAAACACTTGGAC
    TCAAAATTTGAGCCAATCTCCCTTCCCTCCGAAAGAGGCGAATAATAGCAGAGGCTTCAA
    CTGCTGAACTATAGGGTACGTTACATTAATGATACACTTGTGAGTATCAGCCCTGGATAA
    TATAAGTCAATTAAACGACCAAGATAAAATTGTTCATATCTCGCTAGCAGCTTAAAATAT
    AAATGTAATAGGAGCTATATCTCTGACAGTATTATAATCAATTGTTATTAAGTAACCCAA
    ACCAAAAGTGATGAAGATTAAGAAAAACCTACCTCGGCTGAGAGAGTGTTTTTTCATTAA
    CCTTCATCTTGTAAACGTTGAGCAAAATTGTTAAAAATATGAGGCGGGTTATATTGCCTA
    CTGCTCCTCCTGAATATATGGAGGCCATATACCCTGTCAGGTCAAATTCAACAATTGCTA
    GAGGTGGCAACAGCAATACAGGCTTCCTGACACCGGAGTCAGTCAATGGGGACACTCCAT
    CGAATCCACTCAGGCCAATTGCCGATGACACCATCGACCATGCCAGCCACACACCAGGCA
    GTGTGTCATCAGCATTCATCCTTGAAGCTATGGTGAATGTCATATCGGGCCCCAAAGTGC
    TAATGAAGCAAATTCCAATTTGGCTTCCTCTAGGTGTCGCTGATCAAAAGACCTACAGCT
    TTGACTCAACTACGGCCGCCATCATGCTTGCTTCATACACTATCACCCATTTCGGCAAGG
    CAACCAATCCACTTGTCAGAGTCAATCGGCTGGGTCCTGGAATCCCGGATCATCCCCTCA
    GGCTCCTGCGAATTGGAAACCAGGCTTTCCTCCAGGAGTTCGTTCTTCCGCCAGTCCAAC
    TACCCCAGTATTTCACCTTTGATTTGACAGCACTCAAACTGATCACCCAACCACTGCCTG
    CTGCAACATGGACCGATGACACTCCAACAGGATCAAATGGAGCGTTGCGTCCAGGAATTT
    CATTTCATCCAAAACTTCGCCCCATTCTTTTACCCAACAAAAGTGGGAAGAAGGGGAACA
    GTGCCGATCTAACATCTCCGGAGAAAATCCAAGCAATAATGACTTCACTCCAGGACTTTA
    AGATCGTTCCAATTGATCCAACCAAAAATATCATGGGAATCGAAGTGCCAGAAACTCTGG
    TCCACAAGCTGACCGGTAAGAAGGTGACTTCTAAAAATGGACAACCAATCATCCCTGTTC
    TTTTGCCAAAGTACATTGGGTTGGACCCGGTGGCTCCAGGAGACCTCACCATGGTAATCA
    CACAGGATTGTGACACGTGTCATTCTCCTGCAAGTCTTCCAGCTGTGATTGAGAAGTAAT
    TGCAATAATTGACTCAGATCCAGTTTTATAGAATCTTCTCAGGGATAGTGATAACATCTA
    TTTAGTAATCCGTCCATTAGAGGAGACACTTTTAATTGATCAATATACTAAAGGTGCTTT
    ACACCATTGTCTTTTTTCTCTCCTAAATGTAGAACTTAACAAAAGACTCATAATATACTT
    GTTTTTAAAGGATTGATTGATGAAAGATCATAACTAATAACATTACAAATAATCCTACTA
    TAATCAATACGGTGATTCAAATGTTAATCTTTCTCATTGCACATACTTTTTGCCCTTATC
    CTCAAATTGCCTGCATGCTTACATCTGAGGATAGCCAGTGTGACTTGGATTGGAAATGTG
    GAGAAAAAATCGGGACCCATTTCTAGGTTGTTCACAATCCAAGTACAGACATTGCCCTTC
    TAATTAAGAAAAAATCGGCGATGAAGATTAAGCCGACAGTGAGCGTAATCTTCATCTCTC
    TTAGATTATTTGTTTTCCAGAGTAGGGGTCGTCAGGTCCTTTTCAATCGTGTAACCAAAA
    TAAACTCCACTAGAAGGATATTGTGGGGCAACAACACAATGGGCGTTACAGGAATATTGC
    AGTTACCTCGTGATCGATTCAAGAGGACATCATTCTTTCTTTGGGTAATTATCCTTTTCC
    AAAGAACATTTTCCATCCCACTTGGAGTCATCCACAATAGCACATTACAGGTTAGTGATG
    TCGACAAACTAGTTTGTCGTGACAAACTGTCATCCACAAATCAATTGAGATCAGTTGGAC
    TGAATCTCGAAGGGAATGGAGTGGCAACTGACGTGCCATCTGCAACTAAAAGATGGGGCT
    TCAGGTCCGGTGTCCCACCAAAGGTGGTCAATTATGAAGCTGGTGAATGGGCTGAAAACT
    GCTACAATCTTGAAATCAAAAAACCTGACGGGAGTGAGTGTCTACCAGCAGCGCCAGACG
    GGATTCGGGGCTTCCCCCGGTGCCGGTATGTGCACAAAGTATCAGGAACGGGACCGTGTG
    CCGGAGACTTTGCCTTCCATAAAGAGGGTGCTTTCTTCCTGTATGATCGACTTGCTTCCA
    CAGTTATCTACCGAGGAACGACTTTCGCTGAAGGTGTCGTTGCATTTCTGATACTGCCCC
    AAGCTAAGAAGGACTTCTTCAGCTCACACCCCTTGAGAGAGCCGGTCAATGCAACGGAGG
    ACCCGTCTAGTGGCTACTATTCTACCACAATTAGATATCAGGCTACCGGTTTTGGAACCA
    ATGAGACAGAGTACTTGTTCGAGGTTGACAATTTGACCTACGTCCAACTTGAATCAAGAT
    TCACACCACAGTTTCTGCTCCAGCTGAATGAGACAATATATACAAGTGGGAAAAGGAGCA
    ATACCACGGGAAAACTAATTTGGAAGGTCAACCCCGAAATTGATACAACAATCGGGGAGT
    GGGCCTTCTGGGAAACTAAAAAAACCTCACTAGAAAAATTCGCAGTGAAGAGTTGTCTTT
    CACAGTTGTATCAAACGGAGCCAAAAACATCAGTGGTCAGAGTCCGGCGCGAACTTCTTC
    CGACCCAGGGACCAACACAACAACTGAAGACCACAAAATCATGGCTTCAGAAAATTCCTC
    TGCAATGGTTCAAGTGCACAGTCAAGGAAGGGAAGCTGCAGTGTCGCATCTAACAACCCT
    TGCCACAATCTCCACGAGTCCCCAATCCCTCACAACCAAACCAGGTCCGGACAACAGCAC
    CCATAATACACCCGTGTATAAACTTGACATCTCTGAGGCAACTCAAGTTGAACAACATCA
    CCGCAGAACAGACAACGACAGCACAGCCTCCGACACTCCCTCTGCCACGACCGCAGCCGG
    ACCCCCAAAAGCAGAGAACACCAACACGAGCAAGAGCACTGACTTCCTGGACCCCGCCAC
    CACAACAAGTCCCCAAAACCACAGCGAGACCGCTGGCAACAACAACACTCATCACCAAGA
    TACCGGAGAAGAGAGTGCCAGCAGCGGGAAGCTAGGCTTAATTACCAATACTATTGCTGG
    AGTCGCAGGACTGATCACAGGCGGGAGAAGAACTCGAAGAGAAGCAATTGTCAATGCTCA
    ACCCAAATGCAACCCTAATTTACATTACTGGACTACTCAGGATGAAGGTGCTGCAATCGG
    ACTGGCCTGGATACCATATTTCGGGCCAGCAGCCGAGGGAATTTACATAGAGGGGCTAAT
    GCACAATCAAGATGGTTTAATCTGTGGGTTGAGACAGCTGGCCAACGAGACGACTCAAGC
    TCTTCAACTGTTCCTGAGAGCCACAACTGAGCTACGCACCTTTTCAATCCTCAACCGTAA
    GGCAATTGATTTCTTGCTGCAGCGATGGGGCGGCACATGCCACATTCTGGGACCGGACTG
    CTGTATCGAACCACATGATTGGACCAAGAACATAACAGACAAAATTGATCAGATTATTCA
    TGATTTTGTTGATAAAACCCTTCCGGACCAGGGGGACAATGACAATTGGTGGACAGGATG
    GAGACAATGGATACCGGCAGGTATTGGAGTTACAGGCGTTATAATTGCAGTTATCGCTTT
    ATTCTGTATATGCAAATTTGTCTTTTAGTTTTTCTTCAGATTGCTTCATGGAAAAGCTCA
    GCCTCAAATCAATGAAACCAGGATTTAATTATATGGATTACTTGAATCTAAGATTACTTG
    ACAAATGATAATATAATACACTGGAGCTTTAAACATAGCCAATGTGATTCTAACTCCTTT
    AAACTCACAGTTAATCATAAACAAGGTTTGACATCAATCTAGTTATCTCTTTGAGAATGA
    TAAACTTGATGAAGATTAAGAAAAAGGTAATCTTTCGATTATCTTTAATCTTCATCCTTG
    ATTCTACAATCATGACAGTTGTCTTTAGTGACAAGGGAAAGAAGCCTTTTTATTAAGTTG
    TAATAATCAGATCTGCGAACCGGTAGAGTTTAGTTGCAACCTAACACACATAAAGCATTG
    GTCAAAAAGTCAATAGAAATTTAAACAGTGAGTGGAGACAACTTTTAAATGGAAGCTTCA
    TATGAGAGAGGACGCCCACGAGCTGCCAGACAGCATTCAAGGGATGGACACGACCACCAT
    GTTCGAGCACGATCATCATCCAGAGAGAATTATCGAGGTGAGTACCGTCAATCAAGGAGC
    GCCTCACAAGTGCGCGTTCCTACTGTATTTCATAAGAAGAGAGTTGAACCATTAACAGTT
    CCTCCAGCACCTAAAGACATATGTCCGACCTTGAAAAAAGGATTTTTGTGTGACAGTAGT
    TTTTGCAAAAAAGATCACCAGTTGGAGAGTTTAACTGATAGGGAATTACTCCTACTAATC
    GCCCGTAAGACTTGTGGATCAGTAGAACAACAATTAAATATAACTGCACCCAAGGACTCG
    CGCTTAGCAAATCCAACGGCTGATGATTTCCAGCAAGAGGAAGGTCCAAAAATTACCTTG
    TTGACACTGATCAAGACGGCAGAACACTGGGCGAGACAAGACATCAGAACCATAGAGGAT
    TCAAAATTAAGAGCATTGTTGACTCTATGTGCTGTGATGACGAGGAAATTCTCAAAATCC
    CAGCTGAGTCTTTTATGTGAGACACACCTAAGGCGCGAGGGGCTTGGGCAAGATCAGGCA
    GAACCCGTTCTCGAAGTATATCAACGATTACACAGTGATAAAGGAGGCAGTTTTGAAGCT
    GCACTATGGCAACAATGGGACCGACAATCCCTAATTATGTTTATCACTGCATTCTTGAAT
    ATTGCTCTCCAGTTACCGTGTGAAAGTTCTGCTGTCGTTGTTTCAGGGTTAAGAACATTG
    GTTCCTCAATCAGATAATGAGGAAGCTTCAACCAACCCGGGGACATGCTCATGGTCTGAT
    GAGGGTACCCCTTAATAAGGCTGACTAAAACACTATATAACCTTCTACTTGATCACAATA
    CTCCGTATACCTATCATCATATATTTAATCAAGACGATATCCTTTAAAACTTATTCAGTA
    CTATAATCACTCTCGTTTCAAATTAATAAGATGTGCATGATTGCCCTAATATATGAAGAG
    GTATGATACAACCCTAACAGTGATCAAAGAAAATCATAATCTCGTATCGCTCGTAATATA
    ACCTGCCAAGCATACCTCTTGCACAAAGTGATTCTTGTACACAAATAATGTTTTACTCTA
    CAGGAGGTAGCAACGATCCATCCCATCAAAAAATAAGTATTTCATGACTTACTAATGATC
    TCTTAAAATATTAAGAAAAACTGACGGAACATAAATTCTTTATGCTTCAAGCTGTGGAGG
    AGGTGTTTGGTATTGGCTATTGTTATATTACAATCAATAACAAGCTTGTAAAAATATTGT
    TCTTGTTTCAAGAGGTAGATTGTGACCGGAAATGCTAAACTAATGATGAAGATTAATGCG
    GAGGTCTGATAAGAATAAACCTTATTATTCAGATTAGGCCCCAAGAGGCATTCTTCATCT
    CCTTTTAGCAAAGTACTATTTCAGGGTAGTCCAATTAGTGGCACGTCTTTTAGCTGTATA
    TCAGTCGCCCCTGAGATACGCCACAAAAGTGTCTCTAAGCTAAATTGGTCTGTACACATC
    CCATACATTGTATTAGGGGCAATAATATCTAATTGAACTTAGCCGTTTAAAATTTAGTGC
    ATAAATCTGGGCTAACACCACCAGGTCAACTCCATTGGCTGAAAAGAAGCTTACCTACAA
    CGAACATCACTTTGAGCGCCCTCACAATTAAAAAATAGGAACGTCGTTCCAACAATCGAG
    CGCAAGGTTTCAAGGTTGAACTGAGAGTGTCTAGACAACAAAATATTGATACTCCAGACA
    CCAAGCAAGACCTGAGAAAAAACCATGGCTAAAGCTACGGGACGATACAATCTAATATCG
    CCCAAAAAGGACCTGGAGAAAGGGGTTGTCTTAAGCGACCTCTGTAACTTCTTAGTTAGC
    CAAACTATTCAGGGGTGGAAGGTTTATTGGGCTGGTATTGAGTTTGATGTGACTCACAAA
    GGAATGGCCCTATTGCATAGACTGAAAACTAATGACTTTGCCCCTGCATGGTCAATGACA
    AGGAATCTCTTTCCTCATTTATTTCAAAATCCGAATTCCACAATTGAATCACCGCTGTGG
    GCATTGAGAGTCATCCTTGCAGCAGGGATACAGGACCAGCTGATTGACCAGTCTTTGATT
    GAACCCTTAGCAGGAGCCCTTGGTCTGATCTCTGATTGGCTGCTAACAACCAACACTAAC
    CATTTCAACATGCGAACACAACGTGTCAAGGAACAATTGAGCCTAAAAATGCTGTCGTTG
    ATTCGATCCAATATTCTCAAGTTTATTAACAAATTGGATGCTCTACATGTCGTGAACTAC
    AACGGATTGTTGAGCAGTATTGAAATTGGAACTCAAAATCATACAATCATCATAACTCGA
    ACTAACATGGGTTTTCTGGTGGAGCTCCAAGAACCCGACAAATCGGCAATGAACCGCATG
    AAGCCTGGGCCGGCGAAATTTTCCCTCCTTCATGAGTCCACACTGAAAGCATTTACACAA
    GGATCCTCGACACGAATGCAAAGTTTGATTCTTGAATTTAATAGCTCTCTTGCTATCTAA
    CTAAGGTAGAATACTTCATATTGAGCTAACTCATATATGCTGACTCAATAGTTATCTTGA
    CATCTCTGCTTTCATAATCAGATATATAAGCATAATAAATAAATACTCATATTTCTTGAT
    AATTTGTTTAACCACAGATAAATCCTCACTGTAAGCCAGCTTCCAAGTTGACACCCTTAC
    AAAAACCAGGACTCAGAATCCCTCAAACAAGAGATTCCAAGACAACATCATAGAATTGCT
    TTATTATATGAATAAGCATTTTATCACCAGAAATCCTATATACTAAATGGTTAATTGTAA
    CTGAACCCGCAGGTCACATGTGTTAGGTTTCACAGATTCTATATATTACTAACTCTATAC
    TCGTAATTAACATTAGATAAGTAGATTAAGAAAAAAGCCTGAGGAAGATTAAGAAAAACT
    GCTTATTGGGTCTTTCCGTGTTTTAGATGAAGCAGTTGAAATTCTTCCTCTTGATATTAA
    ATGGCTACACAACATACCCAATACCCAGACGCTAGGTTATCATCACCAATTGTATTGGAC
    CAATGTGACCTAGTCACTAGAGCTTGCGGGTTATATTCATCATACTCCCTTAATCCGCAA
    CTACGCAACTGTAAACTCCCGAAACATATCTACCGTTTGAAATACGATGTAACTGTTACC
    AAGTTCTTGAGTGATGTACCAGTGGCGACATTGCCCATAGATTTCATAGTCCCAGTTCTT
    CTCAAGGCACTGTCAGGCAATGGATTCTGTCCTGTTGAGCCGCGGTGCCAACAGTTCTTA
    GATGAAATCATTAAGTACACAATGCAAGATGCTCTCTTCTTGAAATATTATCTCAAAAAT
    GTGGGTGCTCAAGAAGACTGTGTTGATGAACACTTTCAAGAGAAAATCTTATCTTCAATT
    CAGGGCAATGAATTTTTACATCAAATGTTTTTCTGGTATGATCTGGCTATTTTAACTCGA
    AGGGGTAGATTAAATCGAGGAAACTCTAGATCAACATGGTTTGTTCATGATGATTTAATA
    GACATCTTAGGCTATGGGGACTATGTTTTTTGGAAGATCCCAATTTCAATGTTACCACTG
    AACACACAAGGAATCCCCCATGCTGCTATGGACTGGTATCAGGCATCAGTATTCAAAGAA
    GCGGTTCAAGGGCATACACACATTGTTTCTGTTTCTACTGCCGACGTCTTGATAATGTGC
    AAAGATTTAATTACATGTCGATTCAACACAACTCTAATCTCAAAAATAGCAGAGATTGAG
    GATCCAGTTTGTTCTGATTATCCCAATTTTAAGATTGTGTCTATGCTTTACCAGAGCGGA
    GATTACTTACTCTCCATATTAGGGTCTGATGGGTATAAAATTATTAAGTTCCTCGAACCA
    TTGTGCTTGGCCAAAATTCAATTATGCTCAAAGTACACTGAGAGGAAGGGCCGATTCTTA
    ACACAAATGCATTTAGCTGTAAATCACACCCTAGAAGAAATTACAGAAATGCGTGCACTA
    AAGCCTTCACAGGCTCAAAAGATCCGTGAATTCCATAGAACATTGATAAGGCTGGAGATG
    ACGCCACAACAACTTTGTGAGCTATTTTCCATTCAAAAACACTGGGGGCATCCTGTGCTA
    CATAGTGAAACAGCAATCCAAAAAGTTAAAAAACATGCTACGGTGCTAAAAGCATTACGC
    CCTATAGTGATTTTCGAGACATACTGTGTTTTTAAATATAGTATTGCCAAACATTATTTT
    GATAGTCAAGGATCTTGGTACAGTGTTACTTCAGATAGGAATCTAACACCGGGTCTTAAT
    TCTTATATCAAAAGAAATCAATTCCCTCCGTTGCCAATGATTAAAGAACTACTATGGGAA
    TTTTACCACCTTGACCACCCTCCACTTTTCTCAACCAAAATTATTAGTGACTTAAGTATT
    TTTATAAAAGACAGAGCTACCGCAGTAGAAAGGACATGCTGGGATGCAGTATTCGAGCCT
    AATGTTCTAGGATATAATCCACCTCACAAATTTAGTACTAAACGTGTACCGGAACAATTT
    TTAGAGCAAGAAAACTTTTCTATTGAGAATGTTCTTTCCTACGCACAAAAACTCGAGTAT
    CTACTACCACAATATCGGAACTTTTCTTTCTCATTGAAAGAGAAAGAGTTGAATGTAGGT
    AGAACCTTCGGAAAATTGCCTTATCCGACTCGCAATGTTCAAACACTTTGTGAAGCTCTG
    TTAGCTGATGGTCTTGCTAAAGCATTTCCTAGCAATATGATGGTAGTTACGGAACGTGAG
    CAAAAAGAAAGCTTATTGCATCAAGCATCATGGCACCACACAAGTGATGATTTTGGTGAA
    CATGCCACAGTTAGAGGGAGTAGCTTTGTAACTGATTTAGAGAAATACAATCTTGCATTT
    AGATATGAGTTTACAGCACCTTTTATAGAATATTGCAACCGTTGCTATGGTGTTAAGAAT
    GTTTTTAATTGGATGCATTATACAATCCCACAGTGTTATATGCATGTCAGTGATTATTAT
    AATCCACCACATAACCTCACACTGGAGAATCGAGACAACCCCCCCGAAGGGCCTAGTTCA
    TACAGGGGTCATATGGGAGGGATTGAAGGACTGCAACAAAAACTCTGGACAAGTATTTCA
    TGTGCTCAAATTTCTTTAGTTGAAATTAAGACTGGTTTTAAGTTACGCTCAGCTGTGATG
    GGTGACAATCAGTGCATTACTGTTTTATCAGTCTTCCCCTTAGAGACTGACGCAGACGAG
    CAGGAACAGAGCGCCGAAGACAATGCAGCGAGGGTGGCCGCCAGCCTAGCAAAAGTTACA
    AGTGCCTGTGGAATCTTTTTAAAACCTGATGAAACATTTGTACATTCAGGTTTTATCTAT
    TTTGGAAAAAAACAATATTTGAATGGGGTCCAATTGCCTCAGTCCCTTAAAACGGCTACA
    AGAATGGCACCATTGTCTGATGCAATTTTTGATGATCTTCAAGGGACCCTGGCTAGTATA
    GGCACTGCTTTTGAGCGATCCATCTCTGAGACACGACATATCTTTCCTTGCAGGATAACC
    GCAGCTTTCCATACGTTTTTTTCGGTGAGAATCTTGCAATATCATCATCTCGGGTTCAAT
    AAAGGTTTTGACCTTGGACAGTTAACACTCGGCAAACCTCTGGATTTCGGAACAATATCA
    TTGGCACTAGCGGTACCGCAGGTGCTTGGAGGGTTATCCTTCTTGAATCCTGAGAAATGT
    TTCTACCGGAATCTAGGAGATCCAGTTACCTCAGGCTTATTCCAGTTAAAAACTTATCTC
    CGAATGATTGAGATGGATGATTTATTCTTACCTTTAATTGCGAAGAACCCTGGGAACTGC
    ACTGCCATTGACTTTGTGCTAAATCCTAGCGGATTAAATGTCCCTGGGTCGCAAGACTTA
    ACTTCATTTCTGCGCCAGATTGTACGCAGGACCATCACCCTAAGTGCGAAAAACAAACTT
    ATTAATACCTTATTTCATGCGTCAGCTGACTTCGAAGACGAAATGGTTTGTAAATGGCTA
    TTATCATCAACTCCTGTTATGAGTCGTTTTGCGGCCGATATCTTTTCACGCACGCCGAGC
    GGGAAGCGATTGCAAATTCTAGGATACCTGGAAGGAACACGCACATTATTAGCCTCTAAG
    ATCATCAACAATAATACAGAGACACCGGTTTTGGACAGACTGAGGAAAATAACATTGCAA
    AGGTGGAGCCTATGGTTTAGTTATCTTGATCATTGTGATAATATCCTGGCGGAGGCTTTA
    ACCCAAATAACTTGCACAGTTGATTTAGCACAGATTCTGAGGGAATATTCATGGGCTCAT
    ATTTTAGAGGGAAGACCTCTTATTGGAGCCACACTCCCATGTATGATTGAGCAATTCAAA
    GTGTTTTGGCTGAAACCCTACGAACAATGTCCGCAGTGTTCAAATGCAAAGCAACCAGGT
    GGGAAACCATTCGTGTCAGTGGCAGTCAAGAAACATATTGTTAGTGCATGGCCGAACGCA
    TCCCGAATAAGCTGGACTATCGGGGATGGAATCCCATACATTGGATCAAGGACAGAAGAT
    AAGATAGGACAACCTGCTATTAAACCAAAATGTCCTTCCGCAGCCTTAAGAGAGGCCATT
    GAATTGGCGTCCCGTTTAACATGGGTAACTCAAGGCAGTTCGAACAGTGACTTGCTAATA
    AAACCATTTTTGGAAGCACGAGTAAATTTAAGTGTTCAAGAAATACTTCAAATGACCCCT
    TCACATTACTCAGGAAATATTGTTCACAGGTACAACGATCAATACAGTCCTCATTCTTTC
    ATGGCCAATCGTATGAGTAATTCAGCAACGCGATTGATTGTTTCTACAAACACTTTAGGT
    GAGTTTTCAGGAGGTGGCCAGTCTGCACGCGACAGCAATATTATTTTCCAGAATGTTATA
    AATTATGCAGTTGCACTGTTCGATATTAAATTTAGAAACACTGAGGCTACAGATATCCAA
    TATAATCGTGCTCACCTTCATCTAACTAAGTGTTGCACCCGGGAAGTACCAGCTCAGTAT
    TTAACATACACATCTACATTGGATTTAGATTTAACAAGATACCGAGAAAACGAATTGATT
    TATGACAGTAATCCTCTAAAAGGAGGACTCAATTGCAATATCTCATTCGATAATCCATTT
    TTCCAAGGTAAACGGCTGAACATTATAGAAGATGATCTTATTCGACTGCCTCACTTATCT
    GGATGGGAGCTAGCCAAGACCATCATGCAATCAATTATTTCAGATAGCAACAATTCATCT
    ACAGACCCAATTAGCAGTGGAGAAACAAGATCATTCACTACCCATTTCTTAACTTATCCC
    AAGATAGGACTTCTGTACAGTTTTGGGGCCTTTGTAAGTTATTATCTTGGCAATACAATT
    CTTCGGACTAAGAAATTAACACTTGACAATTTTTTATATTACTTAACTACTCAAATTCAT
    AATCTACCACATCGCTCATTGCGAATACTTAAGCCAACATTCAAACATGCAAGCGTTATG
    TCACGGTTAATGAGTATTGATCCTCATTTTTCTATTTACATAGGCGGTGCTGCAGGTGAC
    AGAGGACTCTCAGATGCGGCCAGGTTATTTTTGAGAACGTCCATTTCATCTTTTCTTACA
    TTTGTAAAAGAATGGATAATTAATCGCGGAACAATTGTCCCTTTATGGATAGTATATCCG
    CTAGAGGGTCAAAACCCAACACCTGTGAATAATTTTCTCTATCAGATCGTAGAACTGCTG
    GTGCATGATTCATCAAGACAACAGGCTTTTAAAACTACCATAAGTGATCATGTACATCCT
    CACGACAATCTTGTTTACACATGTAAGAGTACAGCCAGCAATTTCTTCCATGCATCATTG
    GCGTACTGGAGGAGCAGACACAGAAACAGCAACCGAAAATACTTGGCAAGAGACTCTTCA
    ACTGGATCAAGCACAAACAACAGTGATGGTCATATTGAGAGAAGTCAAGAACAAACCACC
    AGAGATCCACATGATGGCACTGAACGGAATCTAGTCCTACAAATGAGCCATGAAATAAAA
    AGAACGACAATTCCACAAGAAAACACGCACCAGGGTCCGTCGTTCCAGTCCTTTCTAAGT
    GACTCTGCTTGTGGTACAGCAAATCCAAAACTAAATTTCGATCGATCGAGACACAATGTG
    AAATTTCAGGATCATAACTCGGCATCCAAGAGGGAAGGTCATCAAATAATCTCACACCGT
    CTAGTCCTACCTTTCTTTACATTATCTCAAGGGACACGCCAATTAACGTCATCCAATGAG
    TCACAAACCCAAGACGAGATATCAAAGTACTTACGGCAATTGAGATCCGTCATTGATACC
    ACAGTTTATTGTAGATTTACCGGTATAGTCTCGTCCATGCATTACAAACTTGATGAGGTC
    CTTTGGGAAATAGAGAGTTTCAAGTCGGCTGTGACGCTAGCAGAGGGAGAAGGTGCTGGT
    GCCTTACTATTGATTCAGAAATACCAAGTTAAGACCTTATTTTTCAACACGCTAGCTACT
    GAGTCCAGTATAGAGTCAGAAATAGTATCAGGAATGACTACTCCTAGGATGCTTCTACCT
    GTTATGTCAAAATTCCATAATGACCAAATTGAGATTATTCTTAACAACTCAGCAAGCCAA
    ATAACAGACATAACAAATCCTACTTGGTTTAAAGACCAAAGAGCAAGGCTACCTAAGCAA
    GTCGAGGTTATAACCATGGATGCAGAGACAACAGAGAATATAAACAGATCGAAATTGTAC
    GAAGCTGTATATAAATTGATCTTACACCATATTGATCCTAGCGTATTGAAAGCAGTGGTC
    CTTAAAGTCTTTCTAAGTGATACTGAGGGTATGTTATGGCTAAATGATAATTTAGCCCCG
    TTTTTTGCCACTGGTTATTTAATTAAGCCAATAACGTCAAGTGCTAGATCTAGTGAGTGG
    TATCTTTGTCTGACGAACTTCTTATCAACTACACGTAAGATGCCACACCAAAACCATCTC
    AGTTGTAAACAGGTAATACTTACGGCATTGCAACTGCAAATTCAACGAAGCCCATACTGG
    CTAAGTCATTTAACTCAGTATGCTGACTGTGAGTTACATTTAAGTTATATCCGCCTTGGT
    TTTCCATCATTAGAGAAAGTACTATACCACAGGTATAACCTCGTCGATTCAAAAAGAGGT
    CCACTAGTCTCTATCACTCAGCACTTAGCACATCTTAGAGCAGAGATTCGAGAATTAACT
    AATGATTATAATCAACAGCGACAAAGTCGGACTCAAACATATCACTTTATTCGTACTGCA
    AAAGGACGAATCACAAAACTAGTCAATGATTATTTAAAATTCTTTCTTATTGTGCAAGCA
    TTAAAACATAATGGGACATGGCAAGCTGAGTTTAAGAAATTACCAGAGTTGATTAGTGTG
    TGCAATAGGTTCTACCATATTAGAGATTGCAATTGTGAAGAACGTTTCTTAGTTCAAACC
    TTATATTTACATAGAATGCAGGATTCTGAAGTTAAGCTTATCGAAAGGCTGACAGGGCTT
    CTGAGTTTATTTCCGGATGGTCTCTACAGGTTTGATTGAATTACCGTGCATAGTATCCTG
    ATACTTGCAAAGGTTGGTTATTAACATACAGATTATAAAAAACTCATAAATTGCTCTCAT
    ACATCATATTGATCTAATCTCAATAAACAACTATTTAAATAACGAAAGGAGTCCCTATAT
    TATATACTATATTTAGCCTCTCTCCCTGCGTGATAATCAAAAAATTCACAATGCAGCATG
    TGTGACATATTACTGCCGCAATGAATTTAACGCAACATAATAAACTCTGCACTCTTTATA
    ATTAAGCTTTAACGAAAGGTCTGGGCTCATATTGTTATTGATATAATAATGTTGTATCAA
    TATCCTGTCAGATGGAATAGTGTTTTGGTTGATAACACAACTTCTTAAAACAAAATTGAT
    CTTTAAGATTAAGTTTTTTATAATTATCATTACTTTAATTTGTCGTTTTAAAAACGGTGA
    TAGCCTTAATCTTTGTGTAAAATAAGAGATTAGGTGTAATAACCTTAACATTTTTGTCTA
    GTAAGCTACTATTTCATACAGAATGATAAAATTAAAAGAAAAGGCAGGACTGTAAAATCA
    GAAATACCTTCTTTACAATATAGCAGACTAGATAATAATCTTCGTGTTAATGATAATTAA
    GACATTGACCACGCTCATCAGAAGGCTCGCCAGAATAAACGTTGCAAAAAGGATTCCTGG
    AAAAATGGTCGCACACAAAAATTTAAAAATAAATCTATTTCTTCTTTTTTGTGTGTCCA